shRNA Adeno-associated Virus Serotype 2, pH1-(WDR62-shRNA-Seq1)(CAT#: AAV-SI2949WQ)

This product is a WDR62-shRNA encoding AAV, which is based on AAV-2 serotype. The WDR62 gene is proposed to play a role in cerebral cortical development. Mutations in this gene have been associated with microencephaly, cortical malformations, and cognitive disability. The expression of WDR62-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert WDR62-shRNA-Seq1
Related Target/Protein WDR62
Region CDS
TargetSeq CAACTGCATGAAGCAGCACTT
NCBI RefSeq NM_173636
Alternative Names MCPH2; C19orf14
Titer >1*10^10 GC/mL
Related Diseases Microencephaly, cortical malformations, and cognitive disability
Target Gene
Gene ID 284403
Uniprot ID O43379

Related Products

Advertisement