shRNA Adeno-associated Virus Serotype 2, pH1-(Zcchc5-shRNA-Seq1)(CAT#: AAV-SI3068WQ)
This product is a Zcchc5-shRNA encoding AAV, which is based on AAV-2 serotype. The Zcchc5 gene is a member of a family of gag-related retrotransposon genes. These genes appear to have lost the ability to retrotranspose. The expression of Zcchc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Zcchc5-shRNA-Seq1 |
Related Target/Protein | Zcchc5 |
Region | CDS |
TargetSeq | CCACCAACCTATCTGATGTGA |
NCBI RefSeq | NM_199468 |
Alternative Names | Mar3; ZHC5; Mart3; SIRH9; ZCCHC5; RTL3 |
Titer | >1*10^10 GC/mL |