shRNA Adeno-associated Virus Serotype 2, pH1-(ZDHHC19-shRNA-Seq2)(CAT#: AAV-SI0580WQ)

This product is a ZDHHC19-shRNA encoding AAV, which is based on AAV-2 serotype. ZDHHC19 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-cysteine S-palmitoyltransferase activity. The expression of ZDHHC19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert ZDHHC19-shRNA-Seq2
Related Target/Protein ZDHHC19
Region CDS
TargetSeq CTGGCATCTTACATCAAGGCT
NCBI RefSeq NM_144637
Alternative Names DHHC19
Titer >1*10^10 GC/mL
Related Diseases Liver cancer
Target Gene
Gene ID 131540
Uniprot ID Q8WVZ1

Related Products

Inquiry Now
Advertisement