shRNA Adeno-associated Virus Serotype 2, pH1-(ZDHHC3-shRNA-Seq1)(CAT#: AAV-SI0968WQ)
This product is a ZDHHC3-shRNA encoding AAV, which is based on AAV-2 serotype. ZDHHC3 Tyrosine Phosphorylation Regulates Neural Cell Adhesion Molecule Palmitoylation. The expression of ZDHHC3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | ZDHHC3-shRNA-Seq1 |
| Related Target/Protein | ZDHHC3 |
| Region | CDS |
| TargetSeq | CGAAACATTGAGCGGAAACCA |
| NCBI RefSeq | NM_016598 |
| Alternative Names | GODZ; DHHC3; DHHC-3; ZNF373 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast Cancer |
