shRNA Adeno-associated Virus Serotype 2, pH1-(Zfp414-shRNA-Seq1)(CAT#: AAV-SI3081WQ)

This product is a Zfp414-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Zfp414 gene may be involved in transcriptional regulation. The expression of Zfp414-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Zfp414-shRNA-Seq1
Related Target/Protein Zfp414
Region CDS
TargetSeq GTTCGTGATCTAGCACAGCAT
NCBI RefSeq NM_026712
Alternative Names Znf414; 0610030H11Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 328801
Uniprot ID Q9DCK4

Related Products

Inquiry Now
Advertisement