shRNA Adeno-associated Virus Serotype 2, pH1-(ZNF280C-shRNA-Seq2)(CAT#: AAV-SI0945WQ)
This product is a ZNF280C-shRNA encoding AAV, which is based on AAV-2 serotype. The ZNF280C gene encodes a member of the zinc finger domain-containing protein family. The expression of ZNF280C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | ZNF280C-shRNA-Seq2 |
| Related Target/Protein | ZNF280C |
| Region | CDS |
| TargetSeq | GAGCCTTGCTTTGAAGAACAT |
| NCBI RefSeq | NM_017666 |
| Alternative Names | ZPET; SUHW3; ZNF633 |
| Titer | >1*10^10 GC/mL |
