shRNA Adeno-associated Virus Serotype 2, pH1-(ZNF280C-shRNA-Seq2)(CAT#: AAV-SI0945WQ)
This product is a ZNF280C-shRNA encoding AAV, which is based on AAV-2 serotype. The ZNF280C gene encodes a member of the zinc finger domain-containing protein family. The expression of ZNF280C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | ZNF280C-shRNA-Seq2 |
Related Target/Protein | ZNF280C |
Region | CDS |
TargetSeq | GAGCCTTGCTTTGAAGAACAT |
NCBI RefSeq | NM_017666 |
Alternative Names | ZPET; SUHW3; ZNF633 |
Titer | >1*10^10 GC/mL |