shRNA Adeno-associated Virus Serotype 2, pU6-(2310044H10Rik-shRNA-Seq2)(CAT#: AAV-SI1948WQ)

This product is a 2310044H10Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2310044H10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 2310044H10Rik-shRNA-Seq2
Related Target/Protein 2310044H10Rik
Region CDS
TargetSeq GAAGTCTTTCTTTGCCAAATA
NCBI RefSeq NM_197991
Alternative Names Inm02; Mirta22; Emc10; 5430410O10Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 69683
Uniprot ID A0A0X1KG67

Related Products

Advertisement