shRNA Adeno-associated Virus Serotype 2, pU6-(AARSD1-shRNA-Seq1)(CAT#: AAV-SI0343WQ)

This product is a AARSD1-shRNA encoding AAV, which is based on AAV-2 serotype. The AARSD1 gene functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). The expression of AARSD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert AARSD1-shRNA-Seq1
Related Target/Protein AARSD1
Region CDS
TargetSeq GCAGTTGCTGACCATCTATTT
NCBI RefSeq NM_025267
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 80755
Uniprot ID Q9BTE6

Related Products

Inquiry Now
Advertisement