shRNA Adeno-associated Virus Serotype 2, pU6-(ANKS6-shRNA-Seq3)(CAT#: AAV-SI1902WQ)
This product is a ANKS6-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by ANKS6 gene may play a role in renal and cardiovascular development. Mutations in this gene have been shown to cause a form of nephronophthisis (NPHP16), a chronic tubulo-interstitial nephritis. The expression of ANKS6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | ANKS6-shRNA-Seq3 |
Related Target/Protein | ANKS6 |
Region | CDS |
TargetSeq | GAGCTGGGAATTAAGACAGAT |
NCBI RefSeq | NM_173551 |
Alternative Names | PKDR1; SAMD6; NPHP16; ANKRD14 |
Titer | >1*10^10 GC/mL |
Related Diseases | Nephronophthisis |