shRNA Adeno-associated Virus Serotype 2, pU6-(Arhgap22-shRNA-Seq1)(CAT#: AAV-SI2226WQ)
This product is a Arhgap22-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Arhgap22 gene is Rho GTPase-activating protein involved in the signal transduction pathway that regulates endothelial cell capillary tube formation during angiogenesis. The expression of Arhgap22-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Arhgap22-shRNA-Seq1 |
| Related Target/Protein | Arhgap22 |
| Region | CDS |
| TargetSeq | CCACTCAGATGTCAATAAGAT |
| NCBI RefSeq | NM_153800 |
| Alternative Names | RhoGAP2; RhoGap22 |
| Titer | >1*10^10 GC/mL |
