shRNA Adeno-associated Virus Serotype 2, pU6-(BBS5-shRNA-Seq2)(CAT#: AAV-SI1512WQ)

This product is a BBS5-shRNA encoding AAV, which is based on AAV-2 serotype. The BBS5 gene encodes a protein that has been directly linked to Bardet-Biedl syndrome. The primary features of this syndrome include retinal dystrophy, obesity, polydactyly, renal abnormalities and learning disabilities. The expression of BBS5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert BBS5-shRNA-Seq2
Related Target/Protein BBS5
Region CDS
TargetSeq GTGGATATGTTCTTGGCTTTA
NCBI RefSeq NM_152384
Titer >1*10^10 GC/mL
Related Diseases Bardet-Biedl syndrome
Target Gene
Gene ID 129880
Uniprot ID Q8N3I7

Related Products

Advertisement