shRNA Adeno-associated Virus Serotype 2, pU6-(C10orf27-shRNA-Seq2)(CAT#: AAV-SI0480WQ)

This product is a C10orf27-shRNA encoding AAV, which is based on AAV-2 serotype. The C10orf27 gene encodes a protein that regulates thymic epithelial cell proliferation and thymus size. It has been identified as a ligand for the class I human leukocyte antigen (HLA-I) in thymus. The expression of C10orf27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C10orf27-shRNA-Seq2
Related Target/Protein C10orf27
Region CDS
TargetSeq CACAGAGAAGAAGACATCGAA
NCBI RefSeq NM_152710
Alternative Names SPATIAL; TBATA
Titer >1*10^10 GC/mL
Related Diseases Multiple sclerosis (MS)
Target Gene
Gene ID 219793
Uniprot ID Q96M53

Related Products