shRNA Adeno-associated Virus Serotype 2, pU6-(C10orf82-shRNA-Seq1)(CAT#: AAV-SI0299WQ)

This product is a C10orf82-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C10orf82-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C10orf82-shRNA-Seq1
Related Target/Protein C10orf82
Region CDS
TargetSeq CTACAAGGACTTCCTGGAGAT
NCBI RefSeq NM_144661
Titer >1*10^10 GC/mL
Target Gene
Gene ID 143379
Uniprot ID Q8WW14

Related Products

Inquiry Now
Advertisement