shRNA Adeno-associated Virus Serotype 2, pU6-(C1orf126-shRNA-Seq5)(CAT#: AAV-SI2096WQ)

This product is a C1orf126-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C1orf126-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C1orf126-shRNA-Seq5
Related Target/Protein C1orf126
Region 3UTR
TargetSeq GCTTTGATAACCCGATGTGTA
NCBI RefSeq NM_182534
Alternative Names C1orf126
Titer >1*10^10 GC/mL
Target Gene
Gene ID 200197
Uniprot ID B3KW75

Related Products

Advertisement