shRNA Adeno-associated Virus Serotype 2, pU6-(C1orf180-shRNA-Seq1)(CAT#: AAV-SI0382WQ)

This product is a C1orf180-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C1orf180-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C1orf180-shRNA-Seq1
Related Target/Protein C1orf180
Region 3UTR
TargetSeq CGTGGAATAATCAAAGCAAAT
NCBI RefSeq NM_001033660
Alternative Names LINC01555
Titer >1*10^10 GC/mL
Target Gene
Gene ID 439927
Uniprot ID Q8NAE3

Related Products

Advertisement