shRNA Adeno-associated Virus Serotype 2, pU6-(C22orf39-shRNA-Seq1)(CAT#: AAV-SI0407WQ)

This product is a C22orf39-shRNA encoding AAV, which is based on AAV-2 serotype. The absence of the C22orf39 gene may be critical for inducing tumorigenesis. The expression of C22orf39-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C22orf39-shRNA-Seq1
Related Target/Protein C22orf39
Region 3UTR
TargetSeq GCGATGTTCTGCAGGACAATT
NCBI RefSeq NM_173793
Titer >1*10^10 GC/mL
Related Diseases Liver cancer
Target Gene
Gene ID 128977
Uniprot ID Q6P5X5

Related Products

Advertisement