shRNA Adeno-associated Virus Serotype 2, pU6-(Cbwd1-shRNA-Seq3)(CAT#: AAV-SI1953WQ)

This product is a Cbwd1-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Cbwd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Cbwd1-shRNA-Seq3
Related Target/Protein Cbwd1
Region CDS
TargetSeq GCTGGTCTTCATTGGTAGAAA
NCBI RefSeq NM_146097
Alternative Names COBP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55871
Uniprot ID Q9BRT8

Related Products

Advertisement