shRNA Adeno-associated Virus Serotype 2, pU6-(CCDC116-shRNA-Seq3)(CAT#: AAV-SI0108WQ)
This product is a CCDC116-shRNA encoding AAV, which is based on AAV-2 serotype. A cis-eQTL genetic variant of the cancer-testis gene CCDC116 is associated with risk of multiple cancers. The expression of CCDC116-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CCDC116-shRNA-Seq3 |
| Related Target/Protein | CCDC116 |
| Region | CDS |
| TargetSeq | GATGAGGACAAGGATGAGGAT |
| NCBI RefSeq | NM_152612 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | colorectal cancer, breast cancer, esophageal cancer, gastric cancer |
