shRNA Adeno-associated Virus Serotype 2, pU6-(CCDC80-shRNA-Seq1)(CAT#: AAV-SI0491WQ)

This product is a CCDC80-shRNA encoding AAV, which is based on AAV-2 serotype. The CCDC80 gene promotes cell adhesion and matrix assembly. The expression of CCDC80-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CCDC80-shRNA-Seq1
Related Target/Protein CCDC80
Region CDS
TargetSeq GAGTACGGAATGACCTACAAT
NCBI RefSeq NM_199511
Alternative Names CL2; URB; DRO1; SSG1; okuribin
Titer >1*10^10 GC/mL
Related Diseases Metabolic disease
Target Gene
Gene ID 151887
Uniprot ID Q76M96

Related Products