shRNA Adeno-associated Virus Serotype 2, pU6-(Chst15-shRNA-Seq2)(CAT#: AAV-SI1751WQ)

This product is a Chst15-shRNA encoding AAV, which is based on AAV-2 serotype. The Chst15 gene encodes a type II transmembrane glycoprotein that acts as a sulfotransferase to transfer sulfate to the C-6 hydroxal group of chondroitin sulfate. The expression of Chst15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Chst15-shRNA-Seq2
Related Target/Protein Chst15
Region CDS
TargetSeq CTACTTCGCAAGTTCCAATAA
NCBI RefSeq NM_029935
Alternative Names BRAG; GALNAC4S-6ST
Titer >1*10^10 GC/mL
Related Diseases Thrombus
Target Gene
Gene ID 51363
Uniprot ID Q7LFX5

Related Products

Advertisement