shRNA Adeno-associated Virus Serotype 2, pU6-(Cma2-shRNA-Seq1)(CAT#: AAV-SI2220WQ)
This product is a Cma2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Zcchc5 gene has serine-type endopeptidase activity. The expression of Cma2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Cma2-shRNA-Seq1 |
Related Target/Protein | Cma2 |
Region | 3UTR |
TargetSeq | CATCAGAGTCTTCAAGCCAGA |
NCBI RefSeq | NM_001024714 |
Alternative Names | Mcp10 |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 545055 |
Uniprot ID | A0A2I3BR33 |