shRNA Adeno-associated Virus Serotype 2, pU6-(CREG2-shRNA-Seq2)(CAT#: AAV-SI0234WQ)

This product is a CREG2-shRNA encoding AAV, which is based on AAV-2 serotype. Human and mouse CREG2 are putative secreted glycoproteins and may be novel neuronal extracellular molecules. The expression of CREG2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CREG2-shRNA-Seq2
Related Target/Protein CREG2
Region CDS
TargetSeq CCTCGCTGATGCTGCCAGAAT
NCBI RefSeq NM_153836
Titer >1*10^10 GC/mL
Related Diseases Brain disease
Target Gene
Gene ID 200407
Uniprot ID Q8IUH2

Related Products

Inquiry Now
Advertisement