shRNA Adeno-associated Virus Serotype 2, pU6-(Ctu2-shRNA-Seq2)(CAT#: AAV-SI1789WQ)

This product is a Ctu2-shRNA encoding AAV, which is based on AAV-2 serotype. The Ctu2 gene a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs) and plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. The expression of Ctu2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Ctu2-shRNA-Seq2
Related Target/Protein Ctu2
Region CDS
TargetSeq CCATGGCTATTGCAAGGTAAT
NCBI RefSeq NM_153775
Alternative Names MFRG; NCS2; UPF0432; C16orf84
Titer >1*10^10 GC/mL
Target Gene
Gene ID 348180
Uniprot ID Q2VPK5

Related Products