shRNA Adeno-associated Virus Serotype 2, pU6-(DDX3X-shRNA-Seq3)(CAT#: AAV-SI0003WQ)

This product is a DDX3X-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DDX3X has ATP-dependent RNA helicase activity and display a high level of RNA-independent ATPase activity. Misregulation of this gene has been implicated in tumorigenesis and alternative splicing results in multiple transcript variants. The expression of DDX3X-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DDX3X-shRNA-Seq3
Related Target/Protein DDX3X
Region CDS
TargetSeq CGTAGAATAGTCGAACAAGAT
NCBI RefSeq NM_001356
Alternative Names DBX; DDX3; HLP2; DDX14; CAP-Rf; MRX102
Titer >1*10^10 GC/mL
Related Diseases X-linked recessive inheritance
Target Gene
Gene ID 1654
Uniprot ID O00571

Related Products

Inquiry Now
Advertisement