shRNA Adeno-associated Virus Serotype 2, pU6-(Defb41-shRNA-Seq1)(CAT#: AAV-SI2208WQ)

This product is a Defb41-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by OR8D4 gene has bactericidal activity and may play a role in the antimicrobial protection of sperm and urogenital tract epithelia. The expression of Defb41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Defb41-shRNA-Seq1
Related Target/Protein Defb41
Region CDS
TargetSeq CTGTATCAGATGGAGGAACCA
NCBI RefSeq NM_183124
Alternative Names BD-17; Bd-41; Defb16; Defb17; Gm15386; 9230102D03Rik
Titer >1*10^10 GC/mL
Related Diseases Antimicrobial protection
Target Gene
Gene ID 77673
Uniprot ID Q30KP6

Related Products

Advertisement