shRNA Adeno-associated Virus Serotype 2, pU6-(DOLK-shRNA-Seq1)(CAT#: AAV-SI0464WQ)

This product is a DOLK-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DOLK gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man. The expression of DOLK-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DOLK-shRNA-Seq1
Related Target/Protein DOLK
Region CDS
TargetSeq GCAGATCATTTCTGTAGCTCT
NCBI RefSeq NM_014908
Alternative Names DK; DK1; CDG1M; SEC59; TMEM15
Titer >1*10^10 GC/mL
Related Diseases Dolichol kinase deficiency
Target Gene
Gene ID 22845
Uniprot ID Q9UPQ8

Related Products