shRNA Adeno-associated Virus Serotype 2, pU6-(EFCAB4A-shRNA-Seq1)(CAT#: AAV-SI0389WQ)
This product is a EFCAB4A-shRNA encoding AAV, which is based on AAV-2 serotype. The EFCAB4A gene plays a role in store-operated Ca2+ entry (SOCE). The expression of EFCAB4A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | EFCAB4A-shRNA-Seq1 |
Related Target/Protein | EFCAB4A |
Region | CDS |
TargetSeq | GCTGTTTCTGCTGTGTGACAA |
NCBI RefSeq | NM_173584 |
Alternative Names | CRACR2B |
Titer | >1*10^10 GC/mL |
Related Diseases | Chronic bronchitis |