shRNA Adeno-associated Virus Serotype 2, pU6-(EWSR1-shRNA-Seq5)(CAT#: AAV-SI0038WQ)

This product is a EWSR1-shRNA encoding AAV, which is based on AAV-2 serotype. The EWSR1 gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The expression of EWSR1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert EWSR1-shRNA-Seq5
Related Target/Protein EWSR1
Region CDS
TargetSeq GCAACAAAGCTATGGAACCTA
NCBI RefSeq NM_005243
Alternative Names EWS; EWS-FLI1; bK984G1.4
Titer >1*10^10 GC/mL
Related Diseases Ewing sarcoma as well as neuroectodermal tumors
Target Gene
Gene ID 2130
Uniprot ID Q01844

Related Products

Advertisement