shRNA Adeno-associated Virus Serotype 2, pU6-(FAM129C-shRNA-Seq3)(CAT#: AAV-SI0429WQ)
This product is a FAM129C-shRNA encoding AAV, which is based on AAV-2 serotype. Based on location and expression of FAM129C gene, this would suggest it has a role in immune system function. The expression of FAM129C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | FAM129C-shRNA-Seq3 |
Related Target/Protein | FAM129C |
Region | CDS |
TargetSeq | CGTGTGTTCTTGGTTCAGCTT |
NCBI RefSeq | NM_173544 |
Alternative Names | BCNP1; FAM129C |
Titer | >1*10^10 GC/mL |
Related Diseases | Colorectal cancer |