shRNA Adeno-associated Virus Serotype 2, pU6-(FAM171A1-shRNA-Seq1)(CAT#: AAV-SI0187WQ)

This product is a FAM171A1-shRNA encoding AAV, which is based on AAV-2 serotype. The FAM171A1 gene is involved in the regulation of the cytoskeletal dynamics and plays a role in actin stress fiber formation. The expression of FAM171A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert FAM171A1-shRNA-Seq1
Related Target/Protein FAM171A1
Region CDS
TargetSeq CGCTCACGTTAGACATTCATA
NCBI RefSeq NM_001010924
Alternative Names APCN; C10orf38
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 221061
Uniprot ID Q5VUB5

Related Products