shRNA Adeno-associated Virus Serotype 2, pU6-(Fbxw16-shRNA-Seq1)(CAT#: AAV-SI1836WQ)

This product is a Fbxw16-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Fbxw16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Fbxw16-shRNA-Seq1
Related Target/Protein Fbxw16
Region CDS
TargetSeq CATATTCTCTCCCTGTCAAAT
NCBI RefSeq NM_177070
Alternative Names 7420402K12Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 320083
Uniprot ID Q497Z0

Related Products

Advertisement