shRNA Adeno-associated Virus Serotype 2, pU6-(GAGE4-shRNA-Seq2)(CAT#: AAV-SI0448WQ)

This product is a GAGE4-shRNA encoding AAV, which is based on AAV-2 serotype. The GAGE4 gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The expression of GAGE4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert GAGE4-shRNA-Seq2
Related Target/Protein GAGE4
Region CDS
TargetSeq GTACAGCCTCCTGAAATGATT
NCBI RefSeq NM_001474
Alternative Names CT4.4
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 2576
Uniprot ID B7ZVY3

Related Products

Inquiry Now
Advertisement