shRNA Adeno-associated Virus Serotype 2, pU6-(Gvin1-shRNA-Seq3)(CAT#: AAV-SI1755WQ)

This product is a Gvin1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gvin1 gene belongs to the TRAFAC class dynamin-like GTPase superfamily. The expression of Gvin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Gvin1-shRNA-Seq3
Related Target/Protein Gvin1
Region CDS
TargetSeq GATCTTACCAGGCAATATATT
NCBI RefSeq NM_029000
Alternative Names GVIN1; VLIG1; GVIN1P; VLIG-1; GVINP1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 387751
Uniprot ID Q7Z2Y8

Related Products

Inquiry Now
Advertisement