shRNA Adeno-associated Virus Serotype 2, pU6-(Hexim1-shRNA-Seq1)(CAT#: AAV-SI2280WQ)

This product is a Hexim1-shRNA encoding AAV, which is based on AAV-2 serotype. Expression of Hexim1 gene is induced by hexamethylene-bis-acetamide in vascular smooth muscle cells. The expression of Hexim1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Hexim1-shRNA-Seq1
Related Target/Protein Hexim1
Region 3UTR
TargetSeq GCCAAGATAAACTTGTGAGAA
NCBI RefSeq NM_138753
Alternative Names CLP1; EDG1; HIS1; MAQ1
Titer >1*10^10 GC/mL
Related Diseases Viral infection
Target Gene
Gene ID 10614
Uniprot ID O94992

Related Products

Advertisement