shRNA Adeno-associated Virus Serotype 2, pU6-(Ints10-shRNA-Seq1)(CAT#: AAV-SI2344WQ)

This product is a Ints10-shRNA encoding AAV, which is based on AAV-2 serotype. Ints10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit and mediates 3-prime end processing of small nuclear RNAs U1 and U2. The expression of Ints10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Ints10-shRNA-Seq1
Related Target/Protein Ints10
Region CDS
TargetSeq GCCGACTTCAACATCCAGTAT
NCBI RefSeq NM_027590
Alternative Names INT10; C8orf35
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55174
Uniprot ID Q9NVR2

Related Products

Inquiry Now
Advertisement