shRNA Adeno-associated Virus Serotype 2, pU6-(JMJD8-shRNA-Seq3)(CAT#: AAV-SI0155WQ)
This product is a JMJD8-shRNA encoding AAV, which is based on AAV-2 serotype. The JMJD8 gene functions as a positive regulator of TNF-induced NF-kappa-B signaling and regulates angiogenesis and cellular metabolism through interaction with PKM. The expression of JMJD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | JMJD8-shRNA-Seq3 |
Related Target/Protein | JMJD8 |
Region | CDS |
TargetSeq | CAGAAGTGATCTACGGTCGTA |
NCBI RefSeq | NM_001005920 |
Alternative Names | PP14397; C16orf20 |
Titer | >1*10^10 GC/mL |
Related Diseases | Colorectal cancer |