shRNA Adeno-associated Virus Serotype 2, pU6-(JMJD8-shRNA-Seq3)(CAT#: AAV-SI0155WQ)

This product is a JMJD8-shRNA encoding AAV, which is based on AAV-2 serotype. The JMJD8 gene functions as a positive regulator of TNF-induced NF-kappa-B signaling and regulates angiogenesis and cellular metabolism through interaction with PKM. The expression of JMJD8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert JMJD8-shRNA-Seq3
Related Target/Protein JMJD8
Region CDS
TargetSeq CAGAAGTGATCTACGGTCGTA
NCBI RefSeq NM_001005920
Alternative Names PP14397; C16orf20
Titer >1*10^10 GC/mL
Related Diseases Colorectal cancer
Target Gene
Gene ID 339123
Uniprot ID Q96S16

Related Products