shRNA Adeno-associated Virus Serotype 2, pU6-(KCTD2-shRNA-Seq2)(CAT#: AAV-SI0417WQ)

This product is a KCTD2-shRNA encoding AAV, which is based on AAV-2 serotype. KCTD2, an adaptor of Cullin3 E3 ubiquitin ligase, suppresses gliomagenesis by destabilizing c-Myc. The expression of KCTD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KCTD2-shRNA-Seq2
Related Target/Protein KCTD2
Region CDS
TargetSeq GCTGGAAATTCGAACAGCTCA
NCBI RefSeq NM_015353
Titer >1*10^10 GC/mL
Related Diseases Ischaemic Stroke and Alzheimer's Disease
Target Gene
Gene ID 23510
Uniprot ID Q14681

Related Products

Advertisement