shRNA Adeno-associated Virus Serotype 2, pU6-(KCTD2-shRNA-Seq2)(CAT#: AAV-SI0417WQ)
This product is a KCTD2-shRNA encoding AAV, which is based on AAV-2 serotype. KCTD2, an adaptor of Cullin3 E3 ubiquitin ligase, suppresses gliomagenesis by destabilizing c-Myc. The expression of KCTD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | KCTD2-shRNA-Seq2 |
Related Target/Protein | KCTD2 |
Region | CDS |
TargetSeq | GCTGGAAATTCGAACAGCTCA |
NCBI RefSeq | NM_015353 |
Titer | >1*10^10 GC/mL |
Related Diseases | Ischaemic Stroke and Alzheimer's Disease |