shRNA Adeno-associated Virus Serotype 2, pU6-(KIAA0802-shRNA-Seq2)(CAT#: AAV-SI0182WQ)

This product is a KIAA0802-shRNA encoding AAV, which is based on AAV-2 serotype. The KIAA0802 gene plays a role in the development and maintenance of non-centrosomal microtubule bundles at the lateral membrane in polarized epithelial cells. The expression of KIAA0802-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert KIAA0802-shRNA-Seq2
Related Target/Protein KIAA0802
Region 3UTR
TargetSeq GCATGGATTATCACAGTATAA
NCBI RefSeq NM_015210
Alternative Names SOGA2; CCDC165; MTCL1
Titer >1*10^10 GC/mL
Related Diseases Microtubules (MTs) growth
Target Gene
Gene ID 23255
Uniprot ID Q9Y4B5

Related Products

Advertisement