shRNA Adeno-associated Virus Serotype 2, pU6-(Lipk-shRNA-Seq1)(CAT#: AAV-SI2228WQ)

This product is a Lipk-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Lipk gene plays a highly specific role in the last step of keratinocyte differentiation and may have an essential function in lipid metabolism of the most differentiated epidermal layers. The expression of Lipk-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Lipk-shRNA-Seq1
Related Target/Protein Lipk
Region CDS
TargetSeq CCTTATCTACTACAAGGAGAT
NCBI RefSeq NM_172837
Alternative Names LIPL2; bA186O14.2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 643414
Uniprot ID Q5VXJ0

Related Products

Advertisement