shRNA Adeno-associated Virus Serotype 2, pU6-(LRRC15-shRNA-Seq2)(CAT#: AAV-SI1810WQ)

This product is a LRRC15-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of LRRC15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LRRC15-shRNA-Seq2
Related Target/Protein LRRC15
Region CDS
TargetSeq CCGTCTTACTCTCTTTGGGAA
NCBI RefSeq NM_130830
Alternative Names LIB
Titer >1*10^10 GC/mL
Target Gene
Gene ID 131578
Uniprot ID Q8TF66

Related Products

Advertisement