shRNA Adeno-associated Virus Serotype 2, pU6-(LRRC49-shRNA-Seq1)(CAT#: AAV-SI0320WQ)

This product is a LRRC49-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of LRRC49-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LRRC49-shRNA-Seq1
Related Target/Protein LRRC49
Region CDS
TargetSeq GCTGACCGTATGTCCTATCAT
NCBI RefSeq NM_017691
Alternative Names PGs4
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 54839
Uniprot ID Q8IUZ0

Related Products

Advertisement