shRNA Adeno-associated Virus Serotype 2, pU6-(Lsm14a-shRNA-Seq5)(CAT#: AAV-SI1782WQ)
This product is a Lsm14a-shRNA encoding AAV, which is based on AAV-2 serotype. The Lsm14a gene encodes Sm-like proteins that are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. The expression of Lsm14a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Lsm14a-shRNA-Seq5 |
Related Target/Protein | Lsm14a |
Region | CDS |
TargetSeq | CTCAGTTAGACCCTTTGAGAA |
NCBI RefSeq | NM_025948 |
Alternative Names | RAP55; FAM61A; RAP55A; C19orf13 |
Titer | >1*10^10 GC/mL |