shRNA Adeno-associated Virus Serotype 2, pU6-(Lypd1-shRNA-Seq1)(CAT#: AAV-SI2276WQ)

This product is a Lypd1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Lypd1 gene may play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. The expression of Lypd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Lypd1-shRNA-Seq1
Related Target/Protein Lypd1
Region CDS
TargetSeq CAGAAAGAAGTGATGGAGCAA
NCBI RefSeq NM_145100
Alternative Names PHTS; LYPDC1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 116372
Uniprot ID Q8N2G4

Related Products

Advertisement