shRNA Adeno-associated Virus Serotype 2, pU6-(Mrpl53-shRNA-Seq3)(CAT#: AAV-SI1877WQ)

This product is a Mrpl53-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Mrpl53 gene may help in protein synthesis within the mitochondrion. The expression of Mrpl53-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Mrpl53-shRNA-Seq3
Related Target/Protein Mrpl53
Region CDS
TargetSeq CAAGCTGGTTCGAGTTCAGTT
NCBI RefSeq NM_026744
Alternative Names L53MT
Titer >1*10^10 GC/mL
Target Gene
Gene ID 116540
Uniprot ID Q96EL3

Related Products

Advertisement