shRNA Adeno-associated Virus Serotype 2, pU6-(Mto1-shRNA-Seq1)(CAT#: AAV-SI2324WQ)

This product is a Mto1-shRNA encoding AAV, which is based on AAV-2 serotype. The Mto1 gene encodes a mitochondrial protein thought to be involved in mitochondrial tRNA modification. The expression of Mto1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Mto1-shRNA-Seq1
Related Target/Protein Mto1
Region CDS
TargetSeq CAAAGTGCTAAACCGGCGTAA
NCBI RefSeq NM_026658
Alternative Names CGI-02; COXPD10
Titer >1*10^10 GC/mL
Related Diseases Deafness
Target Gene
Gene ID 25821
Uniprot ID Q9Y2Z2

Related Products

Advertisement