shRNA Adeno-associated Virus Serotype 2, pU6-(Mvp-shRNA-Seq1)(CAT#: AAV-SI2330WQ)

This product is a Mvp-shRNA encoding AAV, which is based on AAV-2 serotype. The Mvp gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The expression of Mvp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Mvp-shRNA-Seq1
Related Target/Protein Mvp
Region CDS
TargetSeq GTGGAAGTCGTGGAGATCATT
NCBI RefSeq NM_080638
Alternative Names LRP; VAULT1
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 9961
Uniprot ID Q14764

Related Products