shRNA Adeno-associated Virus Serotype 2, pU6-(Nudt16l1-shRNA-Seq1)(CAT#: AAV-SI2317WQ)

This product is a Nudt16l1-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Nudt16l1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Nudt16l1-shRNA-Seq1
Related Target/Protein Nudt16l1
Region CDS
TargetSeq CCTTACCGAAGCTGATTACCT
NCBI RefSeq NM_025839
Alternative Names SDOS; TIRR
Titer >1*10^10 GC/mL
Target Gene
Gene ID 84309
Uniprot ID Q9BRJ7

Related Products

Advertisement