shRNA Adeno-associated Virus Serotype 2, pU6-(OR6B2-shRNA-Seq4)(CAT#: AAV-SI1685WQ)
This product is a OR6B2-shRNA encoding AAV, which is based on AAV-2 serotype. The OR6B2 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR6B2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | OR6B2-shRNA-Seq4 |
Related Target/Protein | OR6B2 |
Region | CDS |
TargetSeq | CTCCATGTCTTTCCTGGAGAT |
NCBI RefSeq | XM_371606 |
Alternative Names | OR2-1; OR6B2P |
Titer | >1*10^10 GC/mL |
Related Diseases | Olfactory dysfunction |