shRNA Adeno-associated Virus Serotype 2, pU6-(PIGX-shRNA-Seq1)(CAT#: AAV-SI2047WQ)

This product is a PIGX-shRNA encoding AAV, which is based on AAV-2 serotype. The PIGX gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER) and the protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I. The expression of PIGX-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PIGX-shRNA-Seq1
Related Target/Protein PIGX
Region CDS
TargetSeq GAAGCCTCGATTGTGGTCAAT
NCBI RefSeq NM_017861
Alternative Names PIG-X
Titer >1*10^10 GC/mL
Target Gene
Gene ID 54965
Uniprot ID Q8TBF5

Related Products

Inquiry Now
Advertisement