shRNA Adeno-associated Virus Serotype 2, pU6-(PLEKHA6-shRNA-Seq2)(CAT#: AAV-SI0388WQ)

This product is a PLEKHA6-shRNA encoding AAV, which is based on AAV-2 serotype. The PLEKHA6 gene is associated with psychopathology and response to treatment in schizophrenic patients.The expression of PLEKHA6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PLEKHA6-shRNA-Seq2
Related Target/Protein PLEKHA6
Region 3UTR
TargetSeq GCCAATTTGATTTGCTAGTAT
NCBI RefSeq NM_014935
Alternative Names PEPP3; PEPP-3
Titer >1*10^10 GC/mL
Related Diseases Schizophrenic
Target Gene
Gene ID 22874
Uniprot ID Q9Y2H5

Related Products